image/svg+xml 0 50 100 150 200 0.00 0.25 0.50 0.75 1.00 Time Number S(t) I(t) R(t) Susceptible Infected Recovered Population Molecular information provides new ways to combat diseases! Inference of outbreaks is based on information about population Molecular information provides new ways to combat diseases! Where are they? What are they made of? Why are they so important? ? ? ? A genome is an organism’s complete set of chromosomes Cromosome Genome Cell What is a GENOME? Cromosome Genome Cell What is a GENOME? Human cells have 46 chromosomes! Cromosome Genome Cell A T T A A T G C C G G C C G DNA double helix Base pairs Cromosome Genome Genes DNA Genes contain instructions for making proteins Proteins Proteins perform many cellular functions Cell Each genome contains ALL of the information needed to build and maintain an organism! The DNA is passed from a parent to its descendants Extracellular matrix Plasma membrane Chromosome The bacterial chromosome is attached to the plasma membrane at the chromosome‘s ori region. 1 The chromosomal DNA replicates. The attachment points separate as the cell grows. 2 Fission is complete; two new cells are formed. 4 The cell begins to divide. 3 From humans to bacteria, all living organisms have a DNA! ? ? ? How come bacteria have different DNAs? DNA replication The two DNA strands are separated like the two sides of a zipper   A T C G A T A T C G A T C G C G C G A T C G A T C G C A T A T A T C G C C C G G A T A A T A T A T A T C G C G A T A T A T A T C G G T Free nucleotides DNA polymerase OriginalDNA Replicationfork Chromosome The enzyme DNA polymerase moves along the exposed DNA strand, joining newly arrived nucleotides into a new DNA strand DNA replication During DNA replication, an incorrect base may be added to the growing chain. DNA replication is very accurate, but sometimes errors happen! These changes are called mutations Other types of damage to DNA also cause mutations! Vancouver exposure to radiation carcinogens Mutations ATGCGATCTGCTAGTCAGTCAGTAGTCGTAGT 5 6 7 TACGCTAGACGATCAGTCAGTCATCAGCATCA CTGCAGTTGAGGACGTAATCTCCAATGCCCATATTAGCGTATCCGAT 1 2 3 4 GACGTCAACTCCTGCATTAGAGGTTACGGGTATAATCGCATAGGCTA Affect only one chromosome(Inversion) ATGCGATCTGCTAGTCAGTCAGTAGTCGTAGT 5 6 7 TACGCTAGACGATCAGTCAGTCATCAGCATCA CTGCAGTTGAGTGGGCATTGGAGATTACGTCTATTAGCGTATCCGAT 1 4 2 GACGTCAACTCACCCGTAACCTCTAATGCAGATAATCGCATAGGCTA 3 Changes in the DNA can affect large pieces of the DNA! Genes ATGCGATCTGCTAGTCAGTCAGTAGTCGTAGT 5 6 7 TACGCTAGACGATCAGTCAGTCATCAGCATCA CTGCAGTTGAGGACGTAATCTCCAATGCCCATATTAGCGTATCCGAT 1 2 3 4 GACGTCAACTCCTGCATTAGAGGTTACGGGTATAATCGCATAGGCTA Affect only one chromosome(Inversion) ATGCGATCTGCTAGTCAGTCAGTAGTCGTAGT 5 6 7 TACGCTAGACGATCAGTCAGTCATCAGCATCA CTGCAGTTGAGTGGGCATTGGAGATTACGTCTATTAGCGTATCCGAT 1 4 2 GACGTCAACTCACCCGTAACCTCTAATGCAGATAATCGCATAGGCTA 3 Genes Multichromosomal events (Translocation) modify only the region order CTGCAGTTGAGGACGTAATCTCCAATGCCCATCTAGTCAGTCAGTAGTCGTAGT 1 2 3 6 7 GACGTCAACTCCTGCATTAGAGGTTACGGGTAGATCAGTCAGTCATCAGCATCA ATGCGATCTGATTAGCGTATCCGAT 5 TACGCTAGACTAATCGCATAGGCTA 4 Mutations Overview of some chromosomal translocations involved in different cancers, as well as implicated in some other conditions, e.g. schizophrenia Duplication modify the region orderand the content Insertion Deletion ATGCGATCTGCTAGTCAGTCAGTAGTCGTAGT 5 6 7 TACGCTAGACGATCAGTCAGTCATCAGCATCA CTGTAATCTCCAGTTGAGGACGTAATCTCCAATGCCCATATTAGCGTATCCGAT 1 2 3 4 2 GACATTAGAGGTCAACTCCTGCATTAGAGGTTACGGGTATAATCGCATAGGCTA CTGCAGTTGAGGACGTAATCTCCAATGCCCATATTAGCGTATCCGAT 1 2 3 4 GACGTCAACTCCTGCATTAGAGGTTACGGGTATAATCGCATAGGCTA ATGCGATCTGCTAGTCAGTCAGTAGTCGTAGTGCTAACCA 5 6 7 TACGCTAGACGATCAGTCAGTCATCAGCATCACGATTGGT 8 ATGCGATCTGCTAGTCAGTCAGTAGTCGTAGT 5 6 7 TACGCTAGACGATCAGTCAGTCATCAGCATCA CTGCAGTTGAGCAATGCCCATATTAGCGTATCCGAT 1 3 4 GACGTCAACTCGTTACGGGTATAATCGCATAGGCTA Mutations ATGCGATCTGCTAGTCAGTCAGTAGTCGTAGT 5 6 7 TACGCTAGACGATCAGTCAGTCATCAGCATCA CTGCAGTTGAGGACGTAATCTCCAATGCCCATATTAGCGTATCCGAT 1 2 3 4 GACGTCAACTCCTGCATTAGAGGTTACGGGTATAATCGCATAGGCTA Changes in the DNA can affect large pieces of the DNA! Genes Cancer is the most common human genetic disease It is caused by mutations occurring in a number of growth-controlling genes Sometimes, mutations can harm the organism that carries them... Sometimes, mutations can be beneficial for the organism that carries them,but not necessarily good for humans! We need to update flu vaccines every year, since their genes mutate too fast! Influenza virus Sickle cell anemia is caused by a mutation in the gene that instructs the building of a protein called hemoglobin In African populations, having this mutation also protects against malaria! Beneficial? Mutations are the raw materials of evolution! lung cancer cell This particular form of cancer is very lethal, with a 5-year survival rate of less than 10 percent. Most cases are caused by smoking Bat-eared fox (Otocyon megalotis) Arctic fox (Alopex lagopus) Adaptations to hot and cold climates Large ears: heat exchangers,passing heat from the fox's blood to the air Thick fur: insulation in the frigid winter central and southern Africa The strong, curved beak of the bald eagle is able to tear the fesh from large fsh and other sizeable prey. The curlew uses its long, curved, pointed beak to extract small crustaceans from the surface of mud, sand, and soil. The roseate spoonbill moves its bill through the water, from which it flters food items. Bird beaks are adaptedto specific types of food items Plants cannot move, but their seeds have adaptations that allow them to travel varying distances fromthe parent plant The seeds of milkweeds aresurrounded by “kites” of fibers thatcarry them on wind currents. Mammals and birds eatblackberries, thendisseminate the seedswhen they defecate. The coconut seed is covered by athick husk that protects it as it driftsacross thousands of miles of ocean. Molecular information provides new ways to combat diseases! ? ? ? How can we read DNA? ???????????????????? A single-stranded DNA fragment is isolated for which the base sequence is to be determined (the template). 1 Step 1: Isolate DNA How to sequence DNA? Chain termination method! Step 2: Create "special" basis CH 2 H H HH HO O O OP O O PPO O O O O O CH 2 H H HH O O OP O O PPO O O O O O 2' Dideoxyribonucleoside triphosphate (ddNTP) 3'2' H H H "Normal" base (A, T, G, or C) "Modified" base (A, T, G, or C) Absence of OH at 3’ position means that additional nucleotides cannot be added. 2 Each special base isbound to a fluorescent dye. G A T C G A T C Step 3: Put everything together! How to sequence DNA? Chain termination method! ???????????????????? C G A T C G A T G A T C A T G Unknown DNA Normal basis Special basis DNA polymerase(for DNA replication)   T C C T A A G A T T A G T T C T G G C T C T C A G G A T T C T A C G Free nucleotides DNA polymerase stops replicationwhen a special base is added The enzyme DNA polymerase moves along the exposed DNA strand, joining newly arrived nucleotides into a new DNA strand Step 4: Let the DNA be replicated How to sequence DNA? Chain termination method! C G A T C G A T G A T C Step 5: Repeat replication a lot of times! How to sequence DNA? Chain termination method! Step 6: Separate and read synthesized fragments How to sequence DNA? Chain termination method! Laser Detector T Electrophoresis Longest fragments move slower EJECT DVD-RW DVD-RW USB SATA PHONE MIC LINE-IN AUDIO POWER POWER CARDREADER Num Lock Caps Lock Scroll Lock Num Lock 7 4 1 / 8 5 2 * 9 6 3 0 - + Scroll Lock Scrn Print SysRq Pause Break Home End Page Down Page Up Insert Delete Enter End Home PgUp PgDn Del . Ins F1 F2 F3 F4 F5 F6 F7 F8 F9 F10 F11 F12 Esc 1 2 3 4 5 6 7 8 9 0 ( ) * & ^ % $ # @ ! ` ~ - _ = + \ | Ctrl Ctrl Alt A S D F G H J K L Caps Lock ; : ' " Z X C V B N M Shift Shift / ? . > , < Alt Gr Q W E R T Y U I O P [ { ] } Tab LCD-Pro LCD-Pro SELECT MENU - + AATCTGGGCTATTCGG 6 The color at the end ofeach fragment is detectedby a laser beam. How to sequence DNA? The chain termination method takes too long when DNA sequences are big... How to sequence DNA? Chain termination method! Genome Cell How to sequence DNA? Shotgun sequencing! The human genome contains approximately 3 billion of these base pairs! DNA is broken up randomly into numerous small segments, which are sequenced using the chain termination method to obtain reads (fragments). ???????????????????? EJECT DVD-RW DVD-RW USB SATA PHONE MIC LINE-IN AUDIO POWER POWER CARDREADER Num Lock Caps Lock Scroll Lock Num Lock 7 4 1 / 8 5 2 * 9 6 3 0 - + Scroll Lock Scrn Print SysRq Pause Break Home End Page Down Page Up Insert Delete Enter End Home PgUp PgDn Del . Ins F1 F2 F3 F4 F5 F6 F7 F8 F9 F10 F11 F12 Esc 1 2 3 4 5 6 7 8 9 0 ( ) * & ^ % $ # @ ! ` ~ - _ = + \ | Ctrl Ctrl Alt A S D F G H J K L Caps Lock ; : ' " Z X C V B N M Shift Shift / ? . > , < Alt Gr Q W E R T Y U I O P [ { ] } Tab LCD-Pro LCD-Pro SELECT MENU - + AATCTGGGCTATTCGG ???????????????????? EJECT DVD-RW DVD-RW USB SATA PHONE MIC LINE-IN AUDIO POWER POWER CARDREADER Num Lock Caps Lock Scroll Lock Num Lock 7 4 1 / 8 5 2 * 9 6 3 0 - + Scroll Lock Scrn Print SysRq Pause Break Home End Page Down Page Up Insert Delete Enter End Home PgUp PgDn Del . Ins F1 F2 F3 F4 F5 F6 F7 F8 F9 F10 F11 F12 Esc 1 2 3 4 5 6 7 8 9 0 ( ) * & ^ % $ # @ ! ` ~ - _ = + \ | Ctrl Ctrl Alt A S D F G H J K L Caps Lock ; : ' " Z X C V B N M Shift Shift / ? . > , < Alt Gr Q W E R T Y U I O P [ { ] } Tab LCD-Pro LCD-Pro SELECT MENU - + AATCTGGGCTATTCGG ???????????????????? EJECT DVD-RW DVD-RW USB SATA PHONE MIC LINE-IN AUDIO POWER POWER CARDREADER Num Lock Caps Lock Scroll Lock Num Lock 7 4 1 / 8 5 2 * 9 6 3 0 - + Scroll Lock Scrn Print SysRq Pause Break Home End Page Down Page Up Insert Delete Enter End Home PgUp PgDn Del . Ins F1 F2 F3 F4 F5 F6 F7 F8 F9 F10 F11 F12 Esc 1 2 3 4 5 6 7 8 9 0 ( ) * & ^ % $ # @ ! ` ~ - _ = + \ | Ctrl Ctrl Alt A S D F G H J K L Caps Lock ; : ' " Z X C V B N M Shift Shift / ? . > , < Alt Gr Q W E R T Y U I O P [ { ] } Tab LCD-Pro LCD-Pro SELECT MENU - + AATCTGGGCTATTCGG Nowadays the shotgun sequence is widely used to sequence all types of genomes... If you are interested to learn more about the biological side: The last two decades have seen a revolution in genome sequencing! Dramatic increases in speed and efficiency + massive reductions in cost DNA sequencing ... even ours! DNA sequencing Sequences always start at the same point... Accumulated mutations in the DNA can help us to combat diseases! 3 How can we use it? Mutations Changes in the DNA can affect large pieces of the DNA! 17 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 18 19 20 21 22 23 Anaplastic large cell lymphoma Burkitt's lymphoma CML, ALL Mantle cell lymphoma Ewing's sarcoma Follicular lymphoma DFSP Acute promyelocytic leukemia Acute myelogenous leukemia CML, ALL Synovial sarcoma Schizophrenia AML Infertility Down syndrome ...but they end in random points (when special base is added) Introduction to genomics for transmission inference Thanks to Priscila Biller for originally creatingthese slides From genomes to phylogenies
1
  1. Genome
  2. Previous class
  3. Questions
  4. Genome
  5. Human Genome
  6. DNA
  7. Proteins
  8. DNA inherited
  9. DNA bacteria
  10. DNA replication
  11. DNA replication details
  12. Mutations
  13. MutationCauses
  14. Rearrangements-Inversion
  15. Rearrangements-MultipleChromTransl
  16. TranslocationDiseases
  17. DupInDel
  18. MutationHarmCancer
  19. MutFlu
  20. FluVaccine1
  21. FluVaccine2
  22. SickleCellAnemia
  23. MutationsEvolution
  24. BirdBeaks
  25. SeedsAdaptation
  26. HowUseMutations
  27. HowReadDNA
  28. Step1Isolate
  29. Step2SpecialBasis
  30. Step3PutTogether
  31. Step4Replication
  32. Step5Repeat
  33. Step6ReadElectrophoresis
  34. LongRead
  35. ShotgunSequencing
  36. SequencesAvailableCost
  37. BookPurves
  38. A